|
Bio-Techne corporation
mouse trem2 antibody Mouse Trem2 Antibody, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+trem2/Mouse+TREM2+Antibody/custom%40af1729%4042379420 Average 96 stars, based on 1 article reviews
mouse trem2 antibody - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Bio-Techne corporation
human/mouse trem2 apc-conjugated antibody Human/Mouse Trem2 Apc Conjugated Antibody, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+trem2/Human%2FMouse+TREM2+APC-conjugated+Antibody/custom%40fab17291a%4042259249 Average 96 stars, based on 1 article reviews
human/mouse trem2 apc-conjugated antibody - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Leico Industries Inc
anti mouse trem2 Anti Mouse Trem2, supplied by Leico Industries Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+trem2/pm42092363-310-47-49 Average 86 stars, based on 1 article reviews
anti mouse trem2 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Abmart Inc
297 mouse anti trem2 297 Mouse Anti Trem2, supplied by Abmart Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+trem2/anti+trem2/10__1016_slash_j__gendis__2026__102263-118-31-36 Average 86 stars, based on 1 article reviews
297 mouse anti trem2 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
R&D Systems
anti human mouse trem2 Anti Human Mouse Trem2, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+trem2/Human%2FMouse+TREM2+Alexa+Fluor%C2%AE+488-conjugated+Antibody/bio_rxiv__64898__2026__04__02__716182-287-25-29 Average 93 stars, based on 1 article reviews
anti human mouse trem2 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
R&D Systems
trem2 Trem2, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+trem2/Human%2FMouse+TREM2+Antibody/pm41896221-95-45-46 Average 95 stars, based on 1 article reviews
trem2 - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
R&D Systems
rat anti trem2 Rat Anti Trem2, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+trem2/Human%2FMouse+TREM2+Antibody/pm41887542-81-12-15 Average 95 stars, based on 1 article reviews
rat anti trem2 - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
R&D Systems
anti trem2 Anti Trem2, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+trem2/Human%2FMouse+TREM2+Antibody/pm41860014-60-7-11 Average 95 stars, based on 1 article reviews
anti trem2 - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
|
OriGene
qpcr primer trem2 fw ctaccagtgtcagagtctccga rev cctcgaaactcgatgactcctc ![]() Qpcr Primer Trem2 Fw Ctaccagtgtcagagtctccga Rev Cctcgaaactcgatgactcctc, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/mouse+trem2/Trem2+Mouse+qPCR+Primer+Pair/pmc13155197-89-0-9 Average 94 stars, based on 1 article reviews
qpcr primer trem2 fw ctaccagtgtcagagtctccga rev cctcgaaactcgatgactcctc - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
Journal: Cell reports
Article Title: Aging disrupts sympathetic innervation of the thymus
doi: 10.1016/j.celrep.2026.117126
Figure Lengend Snippet: (A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( Apoe ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).
Article Snippet:
Techniques: Labeling, MANN-WHITNEY